EST 504667 is a singleton


Sequence

>504667 (1 EST) Length=391 AATAAAATTAAAAAAAGATAGATTTCTTTTTTATTTTTCTTTTTCTTAATAAATAAAAATATAATTATATAAATATTTAT TTAAATAAATAATTAAATAAATATATATATATTTTATAAAACATATAATTTTTCAAAAACGAAACACAAAAATTTAAATA AATAATATATATTATAAGTTTTGNTGCAGCAAAATGGGAAGAGTCAGGACTAAAACTATTAAAAGAGCCGCAAGGCAAAT TGTAGAAAAGTACTATGNCAAATTAACTCTAGATTTTCAAATTAACAAAAAGATAACAGAGGAAGTAGCCATAATTCCCT CAAAGAGAATGAAAAATAAAGTTGCTGGTTTTGTTACTCACTTAATGAAAAGAATACAAAAGGGACCTGTA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr,


Cluster Information for 504667: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
5046671674851N978171340C3czapPFDd2.1, Debopam Chakrabarti


Date: 6:8:49 on Fri 24 Nov 117.