EST 504668 is a singleton


Sequence

>504668 (1 EST) Length=242 CTTTACTAAATTATGAAAAAGAGTCAAAAAATAAAAAATCTTCTTTAAAATGTTTATTACCTTGNCATCCGTATTTAAAT AGTGAATGGAGTTTTGCTTCATATAAATTACCAGGCAAAAAAATTTCATCTATTTGTGCATTTGTTAATGACCAAAATTG TATTATTGTTATCTGCTCAAATGGAATTATTTATAAATTAAGATTTAATGAGCATATCGGAGGTGATATGTTTAAAATAT CA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 504668: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
5046681674852N978181341C3czapPFDd2.1, Debopam Chakrabarti


Date: 6:47:53 on Sat 25 Nov 117.