EST 504675 is a singleton


Sequence

>504675 (1 EST) Length=193 ATTTTGATATCAATATTAAATTTCGCTTTGTATAAATTACAATTTAAAAAAAAAAAAAAAAAAGAAAAATTAATAAATAA ATATTTGAATTATTTATTAGTTTTAAATAAAAAATATATATCCCTCAATAATAAAAAAAATATTAAAAGAATATATATAT TAANCCANCATATATATATATATATATATATAT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr,


Cluster Information for 504675: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
5046751674859N978251356C3czapPFDd2.1, Debopam Chakrabarti


Date: 2:32:25 on Fri 24 Nov 117.