EST 504678 is a singleton


Sequence

>504678 (1 EST) Length=91 GAGAGAGAGAGAGAGAGATCTAGTCTCGAGTTTTATAATAATCACAAATATTTTATGTTATCTTTAATATACTGTTCANT ACCTTCAGAAT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 504678: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
5046781674862N978281361C3czapPFDd2.1, Debopam Chakrabarti


Date: 14:37:14 on Sun 19 Nov 117.