EST 504680 is a singleton


Sequence

>504680 (1 EST) Length=398 GTAAGGGAGGAAATAATTAAATTATCGAAGCAAAATAAATGCAACAATGAATATTCCATGGAATATTGTACCTATTCTGA CGAAAGGAATAGTTCACCGGGTCCTTGTTCTAGAGAAGAAAGAAAGAAATTATGTTGTCAGATTTCAGATTATTGTTTAA AATATTTTAACTTTTATTCAATTGAATATTATAATTGTATAAAATCTGAAATTAAAAGTCCAGAATATAAATGTTTTAAA AGCGAGGGTCAATCAAGCATTCCTTATTTTGCTGCTGGAGGTATTTTAGTTGTAATAGTCTTACTTTTGAGTTCAGCATC TAGAATGGGGAAAAGTAATGAAGAATATGATATAGGAGAATCTAATATAGAAGCAACTTTTGAAGAAAATAATTATTT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 504680: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
5046801674864N978301365C3czapPFDd2.1, Debopam Chakrabarti


Date: 5:56:23 on Thu 23 Nov 117.