EST 504683 is a singleton


Sequence

>504683 (1 EST) Length=310 CTGTGTGTGATTTTTTTTAAATTTGTAAAATACAGATTAAATGAATAAAAATATAGAATTAAAAAATAATATATAAATAT ATATATGCACAGCATATATATATATATATATATATATATTTATATATGTATATAATNNAAAAACGTTTAAAAATGTTTAT AACATATTTTAACAACCCCAACACATTTAATAACTTTTTAGTAACATATAGGACATATATATATATATGTGTACACCTTT ATATATATGTATACCTTCTCCCCAGACGTGTAACATTTTCATTTANCCCAATTTTTTTCTCTCATTTNCC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST, Processing,


Cluster Information for 504683: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
5046831674867N978491376C3czapPFDd2.1, Debopam Chakrabarti


Date: 23:19:2 on Sun 19 Nov 117.