EST 504684 is a singleton


Sequence

>504684 (1 EST) Length=437 AAAAAATTCTATTATACTTTCCAAAATTAAAATTATTATAAATTTTATAATTCTCTCTTTTGTAATATTTTATTTTCTTA ATATAATATTTTTTTAATATTCATTCTTATAAAAAAACTTTATATTCCTTTTATATTATTTTATTTTAAATAAAATATAA ACATATTATACTTACTTTAAAAAAAATGGCTCATGTAATAACTCGTATTAATGCCCGTGAAATTTTAGATTCTAGAGGAA ACCCAACTGTAGAAGTTGACTTAGAGACCAACTTAGGTATTTTCAGAGCTGCCGCACCATCTGGTGCCTCCACTGGTATT TATGAAGCCTTAGAATTAAGAGATAATGACAAGAGCAGGTACTTAGGAAAGGGTGTTCAAAAAGCTATCAAGAACATTAA TGAAATTATTGCTCCAAAATTGATTGGAATGAATTGT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 504684: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
5046841674868N978501379C3czapPFDd2.1, Debopam Chakrabarti


Date: 11:53:23 on Thu 23 Nov 117.