EST 504686 is a singleton


Sequence

>504686 (1 EST) Length=410 ATGGATTAGAAAATATTATGCCTGTAAAAGGCAAATCAAAAACTAAAGGAAAATACAAAAAGAAAAATAAAAGTAATAAA ATGAATATGGGAAGTGATAATATACTTAAGGATGGTGTACATAAGGATAATAATAATCAAAAGGGCCATAAATATGATGA AAAAAACATTTGTAATGATAAGAACATTCAAGAAATGACCTCGAAAGAGAAAATGTACTTTTATACGAGTAAAAAATCAG TTACCTTTGAGAAGTTGGAGGAAAACGAAAAAATGGATTACCAAATCGAAAATAAATATGATTATCCATTTGTTTGTGAT GCTTGTGAATACGATAGTGACATATATGAAATAATAAACAATGCTTCATTAAAATCAAGGAAATTGTTTATGAACAAAAT ATGGAAAAAG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr,


Cluster Information for 504686: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
5046861674870N978521384C3czapPFDd2.1, Debopam Chakrabarti


Date: 1:30:19 on Sun 19 Nov 117.