EST 504687 is a singleton


Sequence

>504687 (1 EST) Length=298 TAAAATATAATAATTTNATACTTGTCAAAAATTTTATTATCGCAATTTATATTTTAAAATGGCTAAAGATAAGAAACAAC AAAAAAAACCCTCTAAAAAAACACCAGGACCTTGCCCCNTATCAACAAAAGTCACAGTGAAAAAAGAAATANAGAAGGAA AAGAAAACAGGAATTAAAGATAACCCTTTAATTTTTGAAAAAAAAAAGAGAAGCAATATTATTGGTGTTGGAGTACGTCC AAAAAAAGATTTATCGAAATATGTTAAATGGCCAAGATATATAAGAATACAAAGAAAG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 504687: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
5046871674871N978531388C3czapPFDd2.1, Debopam Chakrabarti


Date: 7:11:46 on Mon 20 Nov 117.