EST 504688 is a singleton


Sequence

>504688 (1 EST) Length=386 CAAATCATTATCATATTATAAAATAACTTGTAGAGATAATGGTAAAGGAAGCAAAATAAAAGATTTAGAAAAATTTTCTG AAATATTTTTAACGTCAAAAGATAACTGTTCAACTAGTGGTAAATTTGGTATAGGATTAAAGACTATATTATTATATTCC CTTAAAACAGCTTATGGCTTTTTACATATAAAAGTAAAAGTTGAAGAAAACAAAATATGGGACTTCATGTTAGTAATGGA TAAAAATTTAAACCATACTTTTATACAAAATTTTAAAGAATATATAGATACAAACTGGAATTGGTCTGTAGAAATATCAT TAATATTAAAAATAAATAATAAATTTATACATGATCAAAGAATATATACATATATTAAATTAGTCT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr,


Cluster Information for 504688: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
5046881674872N978541389C3czapPFDd2.1, Debopam Chakrabarti


Date: 4:19:36 on Thu 23 Nov 117.