EST 504692 is a singleton


Sequence

>504692 (1 EST) Length=305 ATGCATTAATTAATATCGACAGGAATCATGTCTTGTTAGATGATCATAAGAAAAAAGAGGAGAAGTATGTTGAAAGTGGA GGGGGAGTGAATATGAATATATATACAAAAGAGGAACATGATAAGAATATTGTGAGTGATGATCACAATATAGATGATGA TGATGATGANTATATATATGAAAAACTGAAAGATAGTAAACACCTTATAGAAAAGGATGTTCCCCATGTTGCTGACGTTG ACAGCGTTAATGTTGATGAAAAAGAAAGTATATCCTTAGATGGAACCGGTAGCAGTGCACGTAAA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 504692: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
5046921674876N978581397C3czapPFDd2.1, Debopam Chakrabarti


Date: 15:8:11 on Fri 24 Nov 117.