EST 504697 is a singleton


Sequence

>504697 (1 EST) Length=349 AGATAGTTGATGAAAATGAAATAATGGATAAAATAAAAAATTTGAATATAAATCATATGGATTATGAACAGCAACAGCAT TGTATAAAGAAGCTGGTAAAGAAATGTATTAAGAAATATAAGAAATTATTGAAATTAATAAAGAAGGTAATATTATTATC TGTAGAAAATGGGAATCAAGTGAATGAAGAAGAAAATCAATCACAGGTGGCACTTGAACACGAACAACAAGAAGATGTAT TGTCATCTGGTAGAGGAAGAAGAACACGAACGGGTACACGAACAAGTACAAGAACAANTACAAGAAGAGATATGGATTAT AAGAAAATGGAAGGAGGAAGAAGAGGTGG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 504697: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
5046971674881N978631405C3czapPFDd2.1, Debopam Chakrabarti


Date: 16:12:53 on Fri 17 Nov 117.