EST 504704 is a singleton


Sequence

>504704 (1 EST) Length=287 TACACAAGTCACTCTACCTGTTATATTAAATAANCTAACCATTAAAAGTATTAATGATATATATTTAAGAGCCATTAGTA ATGTTATGAAATATAAGGAGTTTAAAAACATCTTCCAATTATCAGAAGATNAAGAACCATATGATTCATTCGTATATTTC TTCGACAAATTTACTTATATTTATAATGTCAGAACGTATTATCAAAATTATAATGAAATTGAAACATTTAGNACACCACA AAATTTAAAATGGAATTATTTCTATTACTTGTTAAAAAATGGATTAA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 504704: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
5047041674888N978701422C3czapPFDd2.1, Debopam Chakrabarti


Date: 16:25:13 on Mon 20 Nov 117.