EST 504705 is a singleton


Sequence

>504705 (1 EST) Length=385 TTCCACTTCTTTTTTACAAGATGTTAAAAAAAAATCTGATCCACATAACAACGATTTTCAATCATCTTTAAAAGAAGATC AAGAAAATTATTATATTAATTTATTAAAAAATATAAAAGATCCAACAGATAAGGCTATACGTATGATGCAATTAGATGTC GTACCTAAGTATCTACCATGTCGCGAAAAAGAAATTAAAGAAGTACATGGGTTCTTAGAATCAGGAATTAAACAATCTGG AAGTAATCAAATTTTATATATCAGTGGAATGCCAGGAACAGGGAAGACCGCAACAGTCTATAGTGTAATACAATTATTAC AAATTAAAAGTAGAAAAAAATTATTACCATCTTTTAATGTATTTGAAATTAATGGTATGAATGTT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 504705: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
5047051674889N978711424C3czapPFDd2.1, Debopam Chakrabarti


Date: 23:37:11 on Fri 17 Nov 117.