EST 504720 is a singleton


Sequence

>504720 (1 EST) Length=243 GAAAGTTGGTGAGGCAGCTAAATTAGAAGCTACGTTACATCCTACTCAAACAGTTTTTGATGTAAAGAGATTAATAGGAA GAAAATTTGATGACCAAGAAGTTGTTAAAGATCGTTCTNTATTACCATATGAAATTGTNAATAATCAACGCAAACCAAAT ATTAAGGTACAAATAAAGGATAAAGATACTACATTTGCTCCTGAACAAATTAGTGCTATGGTTTCAGAAAAAATGAAAGA AAT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 504720: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
5047201674904N978861452C3czapPFDd2.1, Debopam Chakrabarti


Date: 12:43:32 on Tue 21 Nov 117.