EST 504722 is a singleton


Sequence

>504722 (1 EST) Length=442 GTTGTTCACGGAGGTCTATCTAGATATCAAGATATAACATTGAAAGAAATCGACGAACTCGATAGAAAGAAACAGGAAAT TCTTCATCCAGAACAATATGAAGATATAGTAATTTTTGATCTGTTATGGTCCGATCCTCAAAAAAAAGAAGGAATAGGAG GAAATGCACGAGGGAATAATTGTATTACTTTCGGGCCTGATGTAACAGAAATGTTTTTAAAAAATAATAATTTAGATATT TTGATAAGATCGCACCAAGTACCTAAAACTTTAAAAGGTATTGAAAGTCATCATGAAGGGAAATGTATAACTCTTTTTTC TGCTTCAAATTATTGTNACAAAATAAAAAATCTAGGAGCTGCTATTATATTTAATCAAGACCTTACTTTTGAAGTGCAAG AATATATGTCTCCTTCCCTTGAAGTTATAAGAGAGACGTTTG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 504722: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
5047221674906N978881454C3czapPFDd2.1, Debopam Chakrabarti


Date: 20:4:3 on Sat 18 Nov 117.