EST 504727 is a singleton


Sequence

>504727 (1 EST) Length=355 CATTTAATAACTTCTAATAAATTGATTTCATTATTTCTATCAATATTTAAATTTGTTTCTACTGTTACATTTGACAATTT GGTATCACTACTAATTCTTTCTAATTCGTTATTTCGGTTTGATACACTTAAATCAATATTCTCAGAATTAAAATATTCAT CATCTTCTTCTTCTTCTATGGCATCCTCACTTGTAGCTTCATGCTCATTGAAATTTATTTCATGAGCATCAGTACTACAA CTTGAATGATTCTGTTTAAGTTTTAATATGTTCAAATTCTTATTATAATTCTTATTAGGGGTACTAATTGTGTCTATATA ATTTGTAGAATTGTTTGTACTAAGTGAAATATTTT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 504727: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
5047271674911N978931464C3czapPFDd2.1, Debopam Chakrabarti


Date: 0:46:28 on Wed 22 Nov 117.