EST 504729 is a singleton


Sequence

>504729 (1 EST) Length=277 GAGCACTCGAACAAATAAGAATTAAAGTAAATTGTTATTTTGTTAAGGATATGTTAAAGGGAGATGATTATTACGAATTA TATATTCAACTAAACGAAGTTATGAAAGAAGAAATCCATGAAACGCTGGAAAAGGAACATGAAAAGAGAATAAAAACTTT GCAGAGAAAAAAGAAGAAAAAGAAAAAGAAATAAACATCATATTCTTTTATTTTATATAATAGTAAATAATATAAAGTAT TATATTTCACTGTTGCTTGTTTTTATTATTGCCTTAG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 504729: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
5047291674913N978951468C3czapPFDd2.1, Debopam Chakrabarti


Date: 23:3:24 on Wed 22 Nov 117.