EST 504730 is a singleton


Sequence

>504730 (1 EST) Length=362 GTTCATATGGTACTCATTAAAGACAAATTTAATTGGGAAAAAAAAAGACGACCCCTTAATGTTTTTTATACCTGTTATTA ATATTAAGAAGAATGATATGAAACTTAAAATATTGATTATATGGTGGTTGGAAAAATGTGGGATTGAAAATCCTGAGGAG CTTCTAATATTTAATGATGACCTAAATTTATTAGAAGTTTTAAAAAATGATACTAAGTATGATACCTGTTTGGTCGATTT TAACAAGTCAGAAAATAACTGCGTATATATAAATATTCGAGTGAATTTCTAGGAATTTCTCTTTTGAATAGAGATATAAT GTGGCTAATATATGGAACAATGTTAAAAGATTCTAATAATTT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr,


Cluster Information for 504730: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
5047301674914N978961469C3czapPFDd2.1, Debopam Chakrabarti


Date: 6:48:45 on Sat 25 Nov 117.