EST 504736 is a singleton


Sequence

>504736 (1 EST) Length=231 TCAACCAAATTATGAACAAGTCATAACACAAGTAGATCAAAATGGTAATCTATTCAATCAACAGCTTGTAGGAAGTACAG TAATGCAAAATATGACACCACAAGGTGTNAACACGTTAAATTATCCTGCAACGATCAATACTGTATGTGTTCCACAAACA GCTTCTACTACTAATANTNCAACATCGCAACAAGTACACTCCATCCCCACACACAGGCCATNTGNNCCCTA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr,


Cluster Information for 504736: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
5047361674920N979021477C3czapPFDd2.1, Debopam Chakrabarti


Date: 15:20:59 on Thu 23 Nov 117.