EST 504737 is a singleton


Sequence

>504737 (1 EST) Length=340 AAAAAATTCTTGTACCTTTTAAGTAAGAGTTTGAATGAATATGAAGAATATAAAAAATTGCACGATTTAAAAAATGATCA GGATATGAAAAAAATAGATGACAAGAAAAAAGAAAAAGATGATGAGAAAGAAAAACAAATAATAAATAATAATGATAACA ATAGTACATCAACAACTACAATAATAAGCACAAACAATAATATTATTAATAATAATAATAACAATATTAATGGTAATGAT AATAATATTAATATGACAGAAAAGGTTGATGAAGGGATAAATATATCTAAAGACGATTTAGAAAAAGATCTCAAAAGTTT NATTAAAAATGTTAAAATTG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr,


Cluster Information for 504737: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
5047371674921N979031482C3czapPFDd2.1, Debopam Chakrabarti


Date: 19:12:31 on Fri 24 Nov 117.