EST 504746 is a singleton


Sequence

>504746 (1 EST) Length=366 GATGAGTATGATGAGTATGATGAGGATGATGTAGAAGAAGAAATTGATGAAGAAGAAAGGTTAAGAAAATTGATAAGTGA AAATTATCATAATAGATATGATTATACCGTTAAAGATAATTTTGAAATTTTACATAGAAGAGTTGAATGGTTTTATCATT GGTTTATTGAAAGTGCATCAAACATTGAATATGATTATAGATGGAGTGTAATATTACCATATATTATATTTAAACATGAT AAGAGCAAGCCATTTGCAAAAAATAATTTTATTGATAATTTAAACGCTGAATTGTTTAAAAGCCGTTCATCACCTACTAC GAATGTTCAAAAAAAGGATGTTAAGGAAGAAACTATGAATGGTTGT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 504746: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
5047461674930N979121511C3czapPFDd2.1, Debopam Chakrabarti


Date: 4:39:36 on Wed 22 Nov 117.