EST 504758 is a singleton


Sequence

>504758 (1 EST) Length=441 GTTTTTTTTTTTTTTTTTTATTTTTATTTTTATTTTTATTTTTTATTTTTTATTGTTCATTTTTTTGTTTTATTTTGTTT GTTTCAGAATTCACTAACAAAATTATCCACTTCATCATCAATTTTTTTCAAAACTTTTAAACTATCATGTGAAGAATAAT TATCATAGAGTTTTGTTAAATATTCATTAGCTTCATCAAGTTCATATAAATACAATGAGCATGTTATTAAATTATATAGA ATATCACCGTTATTTATTTGATTTTTTAAAAATTCTTTAGCGTCATTAAATTCATAATTTAGTATGCTTGCTACTGCCTT TCCATTTAATATAATGTTAGAATGGTCATTAATCATTGATCCATATAAAGATTCTAAATCATCAAAAATTAAAAAGGATT CTTTATTATTATCATTAAATAAATAATAAATAGCTAACACA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr,


Cluster Information for 504758: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
5047581674942N979241548C3czapPFDd2.1, Debopam Chakrabarti


Date: 12:46:9 on Sat 18 Nov 117.