EST 504762 is a singleton


Sequence

>504762 (1 EST) Length=328 CTGTGTGTGTATGATAAATAAAAAGGAAAAAAAATTAAAAAATAAAATAATTAATAATATATAACGTATAACATATAATA GTAAGACAAAGACTTGCTAAAACCAAATGTAATTTATATAAATAAATCTTCATTTATGATAATGGCTAAAAACCAGTATA TGGAGGATAGAAATATTAGAGAACCTAATACCTTATTAGGGGAAGAAACTGAACAACTAGTAGATTCATTTCATTATGAA AATAACTCAAGTTCTATTTATAAAAAAGTGAATTCAAATAGGAGTAAAAATGGAAAGCATAGTATGGCGTTTCACAAATC ACTGGCTG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 504762: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
5047621674946N979281553C3czapPFDd2.1, Debopam Chakrabarti


Date: 16:6:32 on Fri 17 Nov 117.