EST 504770 is a singleton


Sequence

>504770 (1 EST) Length=316 TAGTTGTTATTCTTTATATTATATTATTATTATTATAATTATATCATTTTTGAAAAAATATATACTTGCACATTTATATA CAAAATATATATTTAATATTATATAATAACTTGTTATAAATTTTANTATTTATAAATATGTGACTGGNCCATTGATCCAT TCTAAAAATTCTCTTACATTAATAGAACATTTTTGATGTTCATCCAAAGCATTAAAAATAATAAATAAATCTAAAAAGTC AAAATAAATATATCCATTTGTATGATCTGAGCACATTCTGTTGAATTCTTCAAATTGNATTCCGAGATCAGGATCG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr,


Cluster Information for 504770: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
5047701674954N979361566C3czapPFDd2.1, Debopam Chakrabarti


Date: 20:44:57 on Thu 23 Nov 117.