EST 504776 is a singleton


Sequence

>504776 (1 EST) Length=401 AGTAAGAAATTCAAAAAGTCGTTATTTTACAAAGAAGAAAAGCTGCTGAAAAACATTAAAACAAAAAAGAAAAACAATGA GATAAAGAAGAGAAAATATGTCAAATTTTTAATTTTTTTATATCCAGATAATTTGTATATTAATTTTATATTCATTATGT TATATATAAAGACATGGTATTTATAATAAAATATATTTTTATTAACTGTATATATTGATATAGATAGATATAGATTTTTT TTATAATTTATTATTATTTATATGAAATTTTTTTTTTTTTCATTAACATTTTAAAATTAATATATATTTATATTGAAAAA AAAAAAAAAAAACTCGGGGGGGGGCCCGGTACCCAATTCGCCCTATAGCGAGTCGTATTACAATTCACTGGCCGTCGTTT T


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST, Processing,


Cluster Information for 504776: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
5047761674960N979421580C3czapPFDd2.1, Debopam Chakrabarti


Date: 4:28:22 on Wed 22 Nov 117.