EST 504778 is a singleton


Sequence

>504778 (1 EST) Length=300 CAATAATCATACTAATGAACCAAACAATAATCTTACGAATGAACCAAATAATAACCACACTAATGAACCAAATAATAACC ACACTAATGAACCAAACAATAATCATACTAATGAACCAAACAATAATCATNCTAATGAACCAAACAATAATCTTACGTAT GAACCAAATAATAACCATACTAATGAACAAAATAAAGATGATACAAATGAACCAAATAATAATCATACTAATGAACAAAA TAAAGATATTATATGTGACCAAAGCAAAAATGTNATAAATAACCAGAGTACCCATTATGG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST, Processing,


Cluster Information for 504778: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
5047781674962N977041592C3czapPFDd2.1, Debopam Chakrabarti


Date: 13:21:53 on Wed 22 Nov 117.