EST 504779 is a singleton


Sequence

>504779 (1 EST) Length=252 TAAATATGAGTATAATATTTATAATAATAAATATATTGAATTAAAGAAAAGTCATAAAAAATATGGTTTAACAAATCAGA GGCTTATAATTAATTATGAAAGAGGATATTGTTCAGACAATGTAATAAATTATNATAATATAAATAAAGTAATATATAAA ATATATAATAATAAAAAAAAAAATATATACATACATAATAATAATAGTAATAAATATAATAAATATAATAAAAAAACATT AAATTTTAAGAG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 504779: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
5047791674963N977051593C3czapPFDd2.1, Debopam Chakrabarti


Date: 21:15:6 on Fri 24 Nov 117.