EST 504782 is a singleton


Sequence

>504782 (1 EST) Length=365 GAAGAATAGAAAAAGAAATTTGATTTTATATTCACTAGGTTCTGCAGCATTAATAGCTGCCCTTGTCGTTACAGGTATAG GACTTAATATGTATATGAAAAAGAAAAATGTTGACTCTGAGGTACAAGAAATTATAGATGAAAAAGATGAAAAAGTTAAA GAAAAACCAGCTGAGAAAAAAAAAACTACAGTAAAAATAGTTTCCAAAAGAGTTCCTGTAAAATCTAAATCTTCAAATGG TAAATCAAAAGCACGTCCCGCAAATTCGGAGGTATCTCCAAAATTAGATGATGAAAAAAAAGAAGATTTATTAAAATTTA ATGATAATGATCTTTTATTAGCAGCTGAATCATTAAAAGAATTGA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 504782: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
5047821674966N977081607C3czapPFDd2.1, Debopam Chakrabarti


Date: 19:12:15 on Wed 22 Nov 117.