EST 504783 is a singleton


Sequence

>504783 (1 EST) Length=300 ATATATATATATATTTTTTTTTTTTTTGAAGATAAAAAAAAAAGAAAAATATGTGTAATGTATAATTAAAAATATTTTTA GTACTTGAATTATATAAATCATATATTGAATATACCAAGATGATATCCAAGAAGGCGATTGATGAATTTTTACTTTATNT TGCGCAGAAGATGCAAATGTAGAAACCGCTTTGTCTTACTTAGAGATGTGTAATGGTAATGTTGAGGACTCTTTAAAGTT ATNCTATGATATTAATGGTGATAACATGATACCAAATAAACCATATGATAATAATAATAA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 504783: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
5047831674967N977091618C3czapPFDd2.1, Debopam Chakrabarti


Date: 18:9:6 on Fri 17 Nov 117.