EST 504802 is a singleton


Sequence

>504802 (1 EST) Length=395 AAAATTCAAAGGAAATGGTATCAAATAATAAAAATAAAAAGGAACATTATTTGTTAAGCAAACTAAAAATAGAATATGAT AATAATAATGTAGATGAAAATACAATGTTCCTATTGGAAAAATTAAGTTATGAAAATAAGATCGTAGATTCAGAAGAAAT TATAGAAAAGGAAGTTGTAAAGAATATTAATCATACAAAAAATGTTAACATAGAAAATCAAAATAAAATAATATCAAAAG ATAAATTAGATACCATATACCCTAATGTAAATGATAATATTAATAATAAATATGTAACAAATGTCGAAATGGATAATTTA AATATTATGAATAAAGAAGAAGATATAAATAATTTAAGTGATCATTCTATATTATCTTATAAGTCTTTAACATCA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 504802: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
5048021674986N979521713C3czapPFDd2.1, Debopam Chakrabarti


Date: 14:19:7 on Mon 20 Nov 117.