EST 504821 is a singleton


Sequence

>504821 (1 EST) Length=391 GAGAGAGAGAGAGAACGAGTCTGAGTTTTTTTTTTTTTTTTTTTTCATTTTCAATTTTTAATTTTTGATCGGAGGTTTTT ATGATCATATTACAATTTTCTTCCTTTTCATTTGCAATATAATTAATTAATTTGTTGACAACATTATTGTAATCTAATTT ATCAACTCCTCTTTTTTTCTTTTCTAAATATAAGTTCTTATTCAATCCGCTGAAATATTTTCCACTTTCTTTTTCTTTTA TTAAAACTAATTTGGTTCCTTTCTTTGTTACATACATTTCTTCAAATATATAGGTGCATTTGTTTCCTTTTACTATTTCT AAATTATTCTTGTTGCTAGAAATACAAAAATTAAATCCTTTAAATTTGTTGAATGGTCCAACATAAACAAG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 504821: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
5048211675005N979711734C3czapPFDd2.1, Debopam Chakrabarti


Date: 23:24:41 on Mon 20 Nov 117.