EST 504827 is a singleton


Sequence

>504827 (1 EST) Length=400 TTTCCTTTCATTTTTGGGTTTGTTGTTCTCTCTAATATTTAATTTTTTTTTCTTCATATAATATATCCAATTTAACAAAC TTGTACAAAAAATGGTTACAGGTTTATAATCAGGTTTTATTTCTTATATATATTTATATATATAATAAAATAATAATAAT ATAAAAATATATATAGATATATATAATATATATAATATATATATTATATATATTTGAGAGAGAGAATATAAAAAATATTA AAAAAAAAAAAAAAAAAAAAAAAATGACAACTAACAAATTTTTACTTTTAAAAAAAGAAGATTCTTATTTATCCAAGCTG ACACATGAAACAGTAATATTTGGTGAGAATTTATATAAGATCGTTTCAAAGACCCTTAGTAGTAGTAGTACAGATCCATT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 504827: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
5048271675011N979771742C3czapPFDd2.1, Debopam Chakrabarti


Date: 2:31:53 on Mon 20 Nov 117.