EST 504829 is a singleton


Sequence

>504829 (1 EST) Length=374 GATTTTTATACACAAATTCTTACAATCCACAGAAGAGATCAACCTAATTTAATAAATTATTATGTAACGCTTATTAACAA ATTAAAAACTTTTAAATACAATATACAATTAAAAAAAATATTTATACAAAATGTAATAAAAGAAATAAATAAAGAATATA ATTCCTTTCTAATAGATTTACATTACATGTACTTTAAAGTAAAAAAAGAGGTTTCTAATATTAATAATTATGATAATAAT AATGAAGGTCATGAAATACCTTCTATTGCTTTTAATACTTCACACAACAAACACATATATGTGTATAAATCCATAGGGCA TGTTTATAAAAATATTTTAAAAACATTAAAATTAAGATTAGAAGTCTTCTTAAA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr,


Cluster Information for 504829: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
5048291675013N979791745C3czapPFDd2.1, Debopam Chakrabarti


Date: 12:49:35 on Sun 19 Nov 117.