EST 504832 is a singleton


Sequence

>504832 (1 EST) Length=374 AGATAGTACAAAAAATACTGAAACCTCATCAAATAATAATGACACNCCATCAAATAATAATGACACGTCATCATATAATA ATATAGAAAATATATCAAATATTGATGGGAAAAAAAAAAAAAAAAATAAAAATAACAAAAACAAAAACAAAAATAATAAG AACAATAATAAGAACAATAATAATAACATGGAATTTATTGAAATACAAAAAAGGAAAGCTTGGAAAAATTGTTATAATGT AAATAAAAATACATGTAAATATTTATATGTACAATATTTTAATAAATTATTTCCAGACGCTTTAGAGAAATTAAATAATG ATGACAATATGAAATTTTCAAAAACAGTAAGTAAAATGAAACCTTTCAAAGAAC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 504832: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
5048321675016N979821748C3czapPFDd2.1, Debopam Chakrabarti


Date: 12:38:3 on Tue 21 Nov 117.