EST 504834 is a singleton


Sequence

>504834 (1 EST) Length=368 TAAAATACAAAAATAATAAAAATTTGGTCATAACGGTTATACGAAAAATTAAGGGGAACAAAGAAATTCTTAAAAGAGAA ATTAAAAGTATTTGCAATAGTGAGGTCATTGAAAAACCGGATTCGTTTTTAATTCGAGGAAACCACAAAAAGAAAATAAA GGATTATTTTAAATATATTGGTTATTAATAAAAAAGTGAAGGAATAAATTGCCCCTCATTTAATAGTTTCGAAAAGGTAA ATTGTCAAAATAACCTTCGTAATAAAAGTCTCATAAACAATTACACCCAATGAAAAATATTAAAATCAAGATGCTTAGCA GAAACAGAGAAACCCCACAATCTACATTATCAAAATGATCCAGAACTG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST, Processing,


Cluster Information for 504834: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
5048341675018N979841751C3czapPFDd2.1, Debopam Chakrabarti


Date: 17:2:10 on Thu 23 Nov 117.