EST 504835 is a singleton


Sequence

>504835 (1 EST) Length=383 CTCGAGTTTTTTTTTTTTTTTTTTTCACAAGTTGAAGATAAAGAATGATTAATCATATTAGGTGATATATAAACATTTAA AAGATCATTATTATTTTTATTATTATTAAAACCATTACCTTCATTTTGAATATTAACATTTTGTTTATCCATATTTTCAT TATTTATTCTTTGGTCACCCATGTTATCACACTGATTATTCATATTATCATTATTATTATTATTGCTAATTTTTTTACTT TTAGTTTCTCTTTTATTTTTACTTTTATTATTGCTTTTATTTTTCATTTTATTTTTTTTCTTAATTTTTTGGGGGCCCGG TACCCAATTCGCCCTATAGTGAGTCGTATTACAATTCACTGGCCGTCGTTTTACAACGTCGTG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST, Processing,


Cluster Information for 504835: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
5048351675019N979851752C3czapPFDd2.1, Debopam Chakrabarti


Date: 16:24:56 on Fri 17 Nov 117.