EST 504845 is a singleton


Sequence

>504845 (1 EST) Length=258 ATTATTCAAGAATAAAATATTTATGCATTTATTATATGTAATGAAAGCCAAAAAAAAAAGAAGAAAAAAAAAAAAAATTA TACCTTTAAACGAATATTATGATTATTTTAAAAATAATGTAATTTAAGATCTTTTTTTTTTTTTTTTTTTTTTATTTATT TATGTCACTTTTTGNTTTATATCTAAAATAATAATATTCTACTTTAATTTTTAAAATATAGCGAGTTGTTTATTTAATCC TATATATGTATTTATATT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST, Processing,


Cluster Information for 504845: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
5048451675029N979952013C3czapPFDd2.1, Debopam Chakrabarti


Date: 21:51:18 on Fri 17 Nov 117.