EST 504852 is a singleton


Sequence

>504852 (1 EST) Length=323 GCAATGTTTATACTTATGTTTAAATACATCATCGGTGTTGTTTACGAGTGAAAACCGATTCGATTTTATGAGTGGACCTT ACGTCGACAAAAATGGAGATGTGGACTATCAATTAAAGAGAGGAAAAAATTTATACCTTTCTTCTTATAAGTTGAACAAA CTTTTTGACGTTATAATTAATTCAGCAGTTGATGTTGAAATATATAAGCATACGTTGAAATCGGAATAATTACCTCCATA TCTTTTTTTTTTCTTTTTTATCATTTAGTTGTTCATTTAATAGTCCTAAATATATATATATATATATATATATATATATG TGG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr,


Cluster Information for 504852: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
5048521675036N980022022C3czapPFDd2.1, Debopam Chakrabarti


Date: 0:2:53 on Sun 19 Nov 117.