EST 504858 is a singleton


Sequence

>504858 (1 EST) Length=331 TATTATATTTCTTTGGTCCATTTCTTGTACATACGCCTTGTTCAATGTTTCATTTTTTTTATGGAATAAAAATTTTGAGG GTATATTTTTATTCATACTAAAATATATATATTTGTGATATTCATTCAATATATATTTAATAAATCCTGTGTTTTTGGTT TTATTATTCACTGTCTTGTTCCAATTTTTTTTTTCTGCGGAATTGATTTGACGGNCTATAAACTTTTGGAATATATTATA ATATATATTTNNATCATTATTATAAATCCCGTTGTATAACTCTTGGCACTTCTCTNCTTTAATTTTGNACACTTCTTTTT TTAATATGAAG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 504858: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
5048581675042N980082031C3czapPFDd2.1, Debopam Chakrabarti


Date: 23:27:21 on Fri 17 Nov 117.