EST 504859 is a singleton


Sequence

>504859 (1 EST) Length=416 ATTATATTTGAATAATTAAAAAACTTAATTTTTATAAATTTCAAAAAAAAATAAAAATTCATATGTTATTAAATGTAAAA ATAAAGACATTCAAATGTGTAATTTAAAATATACAAATAAAAAAAATATAAATATAAATACAAATAAACCAAAAAAATAA CATATACAAACATTTACTTTAAAATTATATCGACCTTTCTTTTATTTTATTTTATTTTATATTATATTATTTTTTTATTT ATTATTATCAAATGGACAACCATTTTAATTTTTAATTAAATAACGCCTTTGTTTTCAGAAAGTCTTGACCCTGAATTAAA TGCATTTTTTTCTTTCCTGGCGTTCTGTAATCTCTTACTATTGTTATATTGTAATAATCAAAATTGGATATTCCATGGTT TTCATCAAAAATCTTT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 504859: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
5048591675043N980092032C3czapPFDd2.1, Debopam Chakrabarti


Date: 18:53:5 on Thu 23 Nov 117.