EST 504861 is a singleton


Sequence

>504861 (1 EST) Length=358 GTTTTTTTTTTTTTTTTTTCTNCATAGTTAACCACCAAAAGGATTAATATTTTTTAATAGCATGGAAAAGAAAAAATTTA TTAAAATTAGAGCAATTAAGTACAGAATGAACGAAAAGAAAGAAAAGAATTTTTACCAACTTTTTTTTATTCTATATAAA GACAATTTCACATTCATAGTTATAAAAATTAAAAGGAGTACTTAAATATTAAGATGGACAATTATTATTTATTTAAACAA TATATATATATATATATTATTAAAAGTGTTATTTTAATATTTCCTTATATATAAGTAATAATATATATATAATAATAATA AACTTTAATTTGTATTTTTATTCATTCTTTATTTTTTT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 504861: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
5048611675045N980112034C3czapPFDd2.1, Debopam Chakrabarti


Date: 13:37:1 on Fri 24 Nov 117.