EST 504862 is a singleton


Sequence

>504862 (1 EST) Length=390 AAGAATCGTAAAATCATGTCATAGTAAAACATTAGATAAATATGGATTAATTAAATATCCTTTAACATCAGAAAAGGCTA TGAAAAAAATCGAAGAAATAAATACCTTAGTTTTTATGTGTGACAAGAGAGCAAATAAGAAAAACATCAAAAAATCAGTG AAGAATTTATTTGGTATCGAGTGTGATAAAGTTAATGTCTTGAACACATTAAATGGAGATAAAAAGGCTTACGTTCGTTT ATCAGGAGAACATGACGCTTTAGAAGTCGCAAACAAAATAGGCATATTATAAATAATAAAATATGTATGTGAATTTATAT ATATATGTATATATTTACATATGTGTGTATATATGTGTATAACCAACCTTATGCTATTTTTGTTTTATTG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 504862: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
5048621675046N980122039C3czapPFDd2.1, Debopam Chakrabarti


Date: 14:19:26 on Fri 17 Nov 117.