EST 504868 is a singleton


Sequence

>504868 (1 EST) Length=287 AAGATAGAGAAGAAAATTCTGGTAATTTCGAAAAGAGAAAATTCACCAACGTAAGAAAAGATAAATTTTACGAGTCAAGG AGAAGAAGAGATTATGACTACAGGAAGGAATACAGAAGGGATGATTACAGAAGAGATTTTAGAAGAGATGAATTTAGAAG AGGAGGTGGTGAATTTAGACGAGATTATAGAAGAGATGAATTTAGAAGAGGTGGTGGCGACTTTAGAAGATCTAGCAAGA GAAATTGTNCCTTGATTGTTTATAATTTACCTCCACAAGTAACTTGG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 504868: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
5048681675052N980182045C3czapPFDd2.1, Debopam Chakrabarti


Date: 11:44:25 on Wed 22 Nov 117.