EST 504873 is a singleton


Sequence

>504873 (1 EST) Length=281 AGAATTCTTTTGGAACTATGAAAATAAGAAAAGAACAAAATCCAGATTTATCACAAGAGAATCATTATTATTTTCATTTA ATATCAAACTATCCTTTTGTGATAAATCTGGATTTTGTTCTTTTCTTATTTTCATAGTTCCAAAAGGATTAAAACCAGAG AAGAACAAAATCCAGATTTATCACAAAAGGATAGTTTGATATTAAATGAAAATAATAATGATTCTCTTACATCAGCAGAT CAAAAGAATAATAATATGGTTCCTATGGAAAATAGATCATT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Processing,


Cluster Information for 504873: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
5048731675057N980232070C3czapPFDd2.1, Debopam Chakrabarti


Date: 6:24:50 on Thu 23 Nov 117.