EST 504874 is a singleton


Sequence

>504874 (1 EST) Length=57 TGTTAAAATTGGAACGATACAGAGAAGATTAGCATGGCCCCTGCGCGAAAAAAAAAT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 504874: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
5048741675058N980242071C3czapPFDd2.1, Debopam Chakrabarti


Date: 4:18:9 on Fri 24 Nov 117.