EST 504875 is a singleton


Sequence

>504875 (1 EST) Length=383 GAAAAATAATAATAACTATATGAATAATCTCTTTTATCAAGAACATAATAATTATTCGACAACTGCTGATAATTTTGCTT CTAACCAAACTCCTCTTATGAAACATCAGAAATTTTATTATGCTGAAAATAGTAATAATAATTATCTTAGTGATTCTGCA AATTATGTAAATGGACAATCTTTCTCAAACAATGATGAATTATTTAAAAATGATTCTTTATATAGTGATAATAATTCTCC TTTAATTAGTAACAATAACAATAATAATAATAATAGTAGTAATAATAATAATAATAATAATAGTAGTGATAATAGTAATA CTAATAATAGTAATAGTAGTAATAACAGTATTAGTAGTAATGCTAACCCAACGAATAATGACT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST, Processing,


Cluster Information for 504875: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
5048751675059N980252075C3czapPFDd2.1, Debopam Chakrabarti


Date: 13:15:25 on Thu 23 Nov 117.