EST 504881 is a singleton


Sequence

>504881 (1 EST) Length=402 GNNCATACAAATAAAAATTCAAGTTGTACTTTTTTAAAAATACAAAAAGGAAAAAATTAAATATATATTTGTCCTTGAAT AAATAAATTTATTTATATTTTCATCTTTTGGGGAAATATATATATATATATATATCATNAAAAAAAATATGAACATATTT TGTTTCTGTCTTGTTATATCCTTCTTATTATTCACCAAAAATAATGAGATAGGTTCTAAATTAATACATCAACCGATTAA TGTATACTATAAAGATTATTCTGAAGGACTAACCATAAATCAAAAAGATAAACTAATGGAAATTTTGNTACATAATTATG ATTATGAATCACAGGATACTACTCCATCACATGATGATCATATAAATATAATTGATGATAAAGAAAAAAACATACAAGCT AT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 504881: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
5048811675065N980312085C3czapPFDd2.1, Debopam Chakrabarti


Date: 8:50:52 on Fri 24 Nov 117.