EST 504888 is a singleton


Sequence

>504888 (1 EST) Length=49 GGTTGACAATTATTTTATGGAACACCATTTATAAATAAATTTACATTTT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 504888: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
5048881675072N980382099C3czapPFDd2.1, Debopam Chakrabarti


Date: 7:21:26 on Mon 20 Nov 117.