EST 504889 is a singleton


Sequence

>504889 (1 EST) Length=415 AAAAAATATAAAAATCTAGAAATATATATGATTTTTTTCATTTATACCTTTAATTTTTAGTTTCCATTATAATATTTTCT ATTTATTAGATAATTATACAAAATGTTTAATGAAAGTGATCATCAAATAAATATTGAATCTCTGCTCAATCAATCTAAAG AATTGCCTAATTTATTGGATCCCTCTGCTACTGAAAATAATTCATTAAATTTATATATAACATTATTTACTATTATATAT ATATATTTGATAATATTCGGGGGTGTTATGATTACCCCTGCAATAAGCCATACAATATCAAATCAGCATCTTTCACATTT ATCTACTAACACACTAAACAATGATAAAGATGAAATAAAACAAACAGAAATTGATACATTTCAAGATATTGAATGTGACT AATATGGCTACATAT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr,


Cluster Information for 504889: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
5048891675073N980392100C3czapPFDd2.1, Debopam Chakrabarti


Date: 6:10:31 on Wed 22 Nov 117.